View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18213_low_22 (Length: 238)
Name: NF18213_low_22
Description: NF18213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18213_low_22 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 73 - 223
Target Start/End: Original strand, 3806289 - 3806439
Alignment:
| Q |
73 |
cagcttatgatcttgttgctcatacacaacatgaatagtggcaatccaaattgttacaaaagcaatggaatcattgtacatgcatgattctcaaattttt |
172 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3806289 |
cagcttatgatcttgttactcatacacaacatgaatagtggcaatccaaattgttacaaaagcaatggaatcattgtacatgcatgattctcaaattttt |
3806388 |
T |
|
| Q |
173 |
gtgctgcatgcagttgtctggtgcaattggtggtttggaattcttggttat |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3806389 |
gtgctgcatgcagttgtctggtgcaattggtggtttggaattcttggttat |
3806439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University