View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18214_high_4 (Length: 250)
Name: NF18214_high_4
Description: NF18214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18214_high_4 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 11 - 250
Target Start/End: Original strand, 31941426 - 31941665
Alignment:
| Q |
11 |
cagagactcgtacacaactcaaacacacaagcgcagccataatgagcaatacatgtgttttttctagtcacataatttatttattacgtactatttcatc |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
31941426 |
cagagactcgtacacaactcaaacacacaagcgcagccataatgagcaatacatgtgttttttctagtcacataattgatttattacgtactatttcatc |
31941525 |
T |
 |
| Q |
111 |
atatttataccatatatatcacatcttcatattgagattaattgtcatcatgttaataattaccattgaattccaaactgcttcagcttcaaatctgact |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
31941526 |
atatttataccatatatatctcatcttcatattgagattaattgtcatcatgttaataattaccattgaattccaaactgcttcagcttcaaacctgact |
31941625 |
T |
 |
| Q |
211 |
caccaacagccatgcttgccgctggagtttgtttcttccc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31941626 |
caccaacagccatgcttgccgctggagtttgtttcttccc |
31941665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University