View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18214_low_7 (Length: 219)
Name: NF18214_low_7
Description: NF18214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18214_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 200
Target Start/End: Original strand, 20988205 - 20988404
Alignment:
| Q |
1 |
aaaagttccggagctgaagaagaaaccggagaatttcgatccgagttcggttgtttgctgggagaaaaacaaacctgtgccgtttttgtttctctcttta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20988205 |
aaaagttccggagctgaagaagaaaccggagaatttcgatccgagttcggttgtttgctgggagaaaaacaaacctgtgccgtttttgtttctctcttta |
20988304 |
T |
|
| Q |
101 |
gcgttcgatttgattagcaaagagaggggaagaattgtgatcactgagattgtgtgtaatctgttgaggactgtgatacatgccacacctgatgatcttg |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20988305 |
gcgtttgatttgattagcaaagagaggggaagaattgtgatcactgagattgtgtgtaatctgttgaggactgtgatacatgccacacctgatgatcttg |
20988404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 5 - 200
Target Start/End: Original strand, 20998441 - 20998636
Alignment:
| Q |
5 |
gttccggagctgaagaagaaaccggagaatttcgatccgagttcggttgtttgctgggagaaaaacaaacctgtgccgtttttgtttctctctttagcgt |
104 |
Q |
| |
|
|||||| |||||||||||||||||| || |||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||| ||| |||| |
|
|
| T |
20998441 |
gttccgcagctgaagaagaaaccggcgagtttcgatccgagttcggttgtttgctgggagaaagacaaacctgttccgtttttgtttctctgtttggcgt |
20998540 |
T |
|
| Q |
105 |
tcgatttgattagcaaagagaggggaagaattgtgatcactgagattgtgtgtaatctgttgaggactgtgatacatgccacacctgatgatcttg |
200 |
Q |
| |
|
| ||| |||||| | ||||||| || || |||||||||||||| |||||||||||| ||||||| |||||||||||||| ||||| || ||||||| |
|
|
| T |
20998541 |
ttgatatgattaacgaagagagtgggaggattgtgatcactgacattgtgtgtaatttgttgagaactgtgatacatgctacaccggaagatcttg |
20998636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University