View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18215_high_16 (Length: 297)
Name: NF18215_high_16
Description: NF18215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18215_high_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 11 - 276
Target Start/End: Original strand, 43034648 - 43034913
Alignment:
| Q |
11 |
agcagagagagcaatgaagagagtagcatcaggcatgcaagtcacgtgccgtacccccacttgtacaacaggtttacttacttttccttcaccactcaca |
110 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43034648 |
agcagagagagcaatgaagagagcagcatcaggcatgcaagtcacgtgccgtacccccacttgtacaacaggtttacttacttttccttcaccactcaca |
43034747 |
T |
|
| Q |
111 |
gttgaacccatcacaaacccttcacccggtaaccactttgaacccaatattgcagaatcaatgcagaatttaccaccttttttcacactcactgtgcctt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43034748 |
gttgaacccatcacaaacccttcacccggtaaccactttgaacccaatattgcagaatcaatgcagaatttaccaccttttttcacactcactgtgcctt |
43034847 |
T |
|
| Q |
211 |
cagcaattggttttgcattaacaggtccattgtcagagaaaagctctatcttgtagcccaagccat |
276 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43034848 |
cagcaattggtattgcattaacaggtccattgtcagagaaaagctctaccttgtagcccaagccat |
43034913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University