View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18215_high_20 (Length: 238)
Name: NF18215_high_20
Description: NF18215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18215_high_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 58 - 224
Target Start/End: Complemental strand, 9120491 - 9120325
Alignment:
| Q |
58 |
aattggagttgaagttttcaatgaagaaaccatttgaggtaaacccatagcctttaacctcgctttgttttctgcaattctctctagtctttgtttctcg |
157 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9120491 |
aattggagttgaagttttcaaggaagaaaccatttgaggtaaacccatagcctttaacctcgctttgttttctgcaattctctctagtctttgtttctcg |
9120392 |
T |
 |
| Q |
158 |
tactccgacaccatggtactactagtaacattccgtacggtttcttctgcttctgattccgatgatg |
224 |
Q |
| |
|
||||| |||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9120391 |
tactcggacatcatggtactactactaacattccgtacggtttcttctgcttctgattccgatgatg |
9120325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University