View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18215_high_22 (Length: 227)
Name: NF18215_high_22
Description: NF18215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18215_high_22 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 51912164 - 51912390
Alignment:
| Q |
1 |
agtcatgttttaatccttcttgtttctgttgctagcacattactatattctctccaaaggagaaaaaatttggagccctttgtcttcacaaaattgcatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51912164 |
agtcatgttttaatccttcttgtttctgttgctagcacattactatattctctccaaaggagaaaaaatttggagccctttgtcttcacaaaattgcatt |
51912263 |
T |
 |
| Q |
101 |
tatataagctagagtataaattttggaaaaataaatgtttataactatgcagtatatggatagtgaatacttgaagcaaatgtaatagctcggtttggaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51912264 |
tatataagctagagtataaattttggaaaaataaatgtttataactatgcagtatatggatagtgaatacttgaagcaaatgtaatagctcggtttggaa |
51912363 |
T |
 |
| Q |
201 |
gttgtaattttgggtatgataagttcc |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
51912364 |
gttgtaattttgggtatgataagttcc |
51912390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 148 - 227
Target Start/End: Original strand, 5692860 - 5692939
Alignment:
| Q |
148 |
tgcagtatatggatagtgaatacttgaagcaaatgtaatagctcggtttggaagttgtaattttgggtatgataagttcc |
227 |
Q |
| |
|
|||| |||||||||||| || || |||||||||| |||||||| ||| | ||||||||||||||||||||||||||| |
|
|
| T |
5692860 |
tgcaatatatggatagttgatgctcgaagcaaatgaaatagctccttttctaggttgtaattttgggtatgataagttcc |
5692939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University