View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18215_high_8 (Length: 361)
Name: NF18215_high_8
Description: NF18215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18215_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 19 - 268
Target Start/End: Original strand, 18217158 - 18217407
Alignment:
| Q |
19 |
tgggatatgaaagccgaggaagctggtggtttaatgaagatttttgctaccgttaaggttccggttgatgttaccgccattaaccatgtttggcaagtgg |
118 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
18217158 |
tgggatatgaaagccgaggaagatggtggtttaatgaagatttttgctaccgttaaggttccggttaatgttaccgccattaaccatgtttggcaagtgg |
18217257 |
T |
 |
| Q |
119 |
ggccctctgtaacggcgggaatgattgctccacatgattttaatccatctaatctgaattcaaaagggagacttagcttgaatggagccaaagattttgg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18217258 |
ggccctctgtaacggcgggaatgattgctccacatgattttaatccatctaatctgaattcaaaagggagacttagcttgaatggagccaaagattttgg |
18217357 |
T |
 |
| Q |
219 |
gaataatgatgatgctcctttggattttgtcaccaagaagaaaaatgtga |
268 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
18217358 |
gaataatgatgatgcccctttggattttgtcaccaagaagaaaaatgtga |
18217407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University