View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18215_low_15 (Length: 304)
Name: NF18215_low_15
Description: NF18215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18215_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 7 - 289
Target Start/End: Complemental strand, 13889031 - 13888748
Alignment:
| Q |
7 |
gatgccaaagcttggtggacgctcccctttcatcatataacatcatcgcaggtcgtccaactctctcaatgctatatgccaactttgtcaaccatgtacc |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
13889031 |
gatgccaaagcttggtggacgctcccctttcattatataacatcatcgcaggtcttccaactctctcaatgctatatgccaactttatcaaccatgtacc |
13888932 |
T |
 |
| Q |
107 |
taacattgaaatgcacactcgataacggtaagatgagaatattgaaaggagaccagggactagagggacattgctacttac-ttgtatagtttgaagaag |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
13888931 |
taacattgaaatgcacactcgataacggtaagatgagaatgttgaaaggagaccagggactagagggacattgctacttactttgtatagtttgaagaag |
13888832 |
T |
 |
| Q |
206 |
ggaaaacttctacttccgataagctcatgcaacgtgaactttacccaacatgtggtgaatttacattccttgagtagtaggaag |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
13888831 |
ggaaaacttctacttccgataagctcatgcaacgtgaactttacccaacatgtggtgaatttacattccttgaggagtaggaag |
13888748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University