View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18215_low_21 (Length: 235)
Name: NF18215_low_21
Description: NF18215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18215_low_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 13 - 221
Target Start/End: Original strand, 22649427 - 22649631
Alignment:
| Q |
13 |
tgcactctcgttttgaaaatcgagctgttacattgtggcatcagagtatggtagtagatttacttcaagggctgtgagtcgggtgtcataagctgatcga |
112 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
22649427 |
tgcactctcgttttgaaaattgagctgttacattgtggcatcagagcatggtagtagatttacttcaaaggttgtgagtcgggtgtcataagctgatcga |
22649526 |
T |
|
| Q |
113 |
gattcgtgtctagtgggcataagtggttagtgtcttatgtgttgtgtgtcttgcttcgggtcaagcataatatgtttactctctaaactaatcctagatg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||| |||| | |||||||||| | |||| |
|
|
| T |
22649527 |
gattcgtgtctagtgggcataagtggttagtgtcttatgtgt--tgtgtcttgctttgggtcaagcataatatg--tactttgtaaactaatctttgatg |
22649622 |
T |
|
| Q |
213 |
tgaagcaat |
221 |
Q |
| |
|
||||||||| |
|
|
| T |
22649623 |
tgaagcaat |
22649631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 38 - 98
Target Start/End: Original strand, 22850004 - 22850064
Alignment:
| Q |
38 |
tgttacattgtggcatcagagtatggtagtagatttacttcaagggctgtgagtcgggtgt |
98 |
Q |
| |
|
||||||||||| | ||||||| ||| |||||||||||||| ||||| ||||| | |||||| |
|
|
| T |
22850004 |
tgttacattgtagtatcagagcatgatagtagatttacttgaagggttgtgaattgggtgt |
22850064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University