View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18216_high_13 (Length: 268)
Name: NF18216_high_13
Description: NF18216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18216_high_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 190 - 251
Target Start/End: Original strand, 8418754 - 8418815
Alignment:
| Q |
190 |
gtcaatcgggtaacctacccctagagcgagtattatgaactcgaaaacccttctccttattc |
251 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8418754 |
gtcaatcaagtaacctacccctagagcgagtattatgaactcgaaaacccttctccttattc |
8418815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 191 - 241
Target Start/End: Complemental strand, 42296378 - 42296328
Alignment:
| Q |
191 |
tcaatcgggtaacctacccctagagcgagtattatgaactcgaaaaccctt |
241 |
Q |
| |
|
|||||| ||||||||||||||| |||| ||||||||||| |||||||||| |
|
|
| T |
42296378 |
tcaatctggtaacctacccctatagcgggtattatgaacctgaaaaccctt |
42296328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 190 - 243
Target Start/End: Complemental strand, 26303930 - 26303877
Alignment:
| Q |
190 |
gtcaatcgggtaacctacccctagagcgagtattatgaactcgaaaacccttct |
243 |
Q |
| |
|
||||||| |||||||||||| ||||||| || |||||||| |||||||||||| |
|
|
| T |
26303930 |
gtcaatccggtaacctacccttagagcgggtgttatgaaccagaaaacccttct |
26303877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 191 - 243
Target Start/End: Complemental strand, 3646883 - 3646831
Alignment:
| Q |
191 |
tcaatcgggtaacctacccctagagcgagtattatgaactcgaaaacccttct |
243 |
Q |
| |
|
|||||| |||||||||||| ||||||||||| ||||| ||||||||||||| |
|
|
| T |
3646883 |
tcaatctggtaacctacccgcggagcgagtattgtgaacccgaaaacccttct |
3646831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 191 - 243
Target Start/End: Complemental strand, 2344431 - 2344379
Alignment:
| Q |
191 |
tcaatcgggtaacctacccctagagcgagtattatgaactcgaaaacccttct |
243 |
Q |
| |
|
|||||| |||||||||||| ||||||||||| ||||| ||||||||||||| |
|
|
| T |
2344431 |
tcaatctggtaacctacccgcggagcgagtattgtgaacccgaaaacccttct |
2344379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University