View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18216_high_21 (Length: 213)
Name: NF18216_high_21
Description: NF18216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18216_high_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 17 - 200
Target Start/End: Original strand, 26846738 - 26846921
Alignment:
| Q |
17 |
agttggcgcatttgagtatagtgaatgtggcagaccaacatgattatgtttggtaagaatgaatgatttctaccatcaatggctcaaactttgaggggga |
116 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26846738 |
agttggcgcatttgagtatagggagagtggcagaccaacatgattatgtttggtaagaatgaatgatttctaccatcaatggctcaaactttgaggggga |
26846837 |
T |
|
| Q |
117 |
agaaaggtcatcttgactcatttttgaaaacgttgggtttgaggaattaattcgtacaaattctgagttcttctgtgtcctttg |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26846838 |
agaaaagtcatcttgactcatttttgaaaacgttgggtttgaggaattaattcgtacaaattctgagttcttctgtgtcctttg |
26846921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University