View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18216_high_6 (Length: 347)
Name: NF18216_high_6
Description: NF18216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18216_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 139 - 337
Target Start/End: Original strand, 41984374 - 41984566
Alignment:
| Q |
139 |
gtaagagttggatgttgtgatgtgatagatagacagatgcgcatattgcaaagaaggtgggcacacacactgacacagcaataaacacggtgtaggtgta |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
41984374 |
gtaagagttggatgttgtgatgtgatagatagacagatgcgcatattgcaaagaaggtgggcacacacactgacacagcaataaacacggtg------ta |
41984467 |
T |
 |
| Q |
239 |
gcgttaaacccttcttctagtcttttgactattccttctcattcaattcaacaccgttactgtttctttcaacgcattctcctggttggttcccctttg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41984468 |
gcgttaaacccttcttctagtcttttgattattccttctcattcaattcaacaccgttactgtttctttcaacgcattctcctggttggttcccctttg |
41984566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University