View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18216_low_14 (Length: 268)

Name: NF18216_low_14
Description: NF18216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18216_low_14
NF18216_low_14
[»] chr5 (1 HSPs)
chr5 (190-251)||(8418754-8418815)
[»] chr3 (2 HSPs)
chr3 (191-241)||(42296328-42296378)
chr3 (190-243)||(26303877-26303930)
[»] chr2 (1 HSPs)
chr2 (191-243)||(3646831-3646883)
[»] chr1 (1 HSPs)
chr1 (191-243)||(2344379-2344431)


Alignment Details
Target: chr5 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 190 - 251
Target Start/End: Original strand, 8418754 - 8418815
Alignment:
190 gtcaatcgggtaacctacccctagagcgagtattatgaactcgaaaacccttctccttattc 251  Q
    |||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||    
8418754 gtcaatcaagtaacctacccctagagcgagtattatgaactcgaaaacccttctccttattc 8418815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 191 - 241
Target Start/End: Complemental strand, 42296378 - 42296328
Alignment:
191 tcaatcgggtaacctacccctagagcgagtattatgaactcgaaaaccctt 241  Q
    |||||| ||||||||||||||| |||| |||||||||||  ||||||||||    
42296378 tcaatctggtaacctacccctatagcgggtattatgaacctgaaaaccctt 42296328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 190 - 243
Target Start/End: Complemental strand, 26303930 - 26303877
Alignment:
190 gtcaatcgggtaacctacccctagagcgagtattatgaactcgaaaacccttct 243  Q
    ||||||| |||||||||||| ||||||| || ||||||||  ||||||||||||    
26303930 gtcaatccggtaacctacccttagagcgggtgttatgaaccagaaaacccttct 26303877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 191 - 243
Target Start/End: Complemental strand, 3646883 - 3646831
Alignment:
191 tcaatcgggtaacctacccctagagcgagtattatgaactcgaaaacccttct 243  Q
    |||||| ||||||||||||   ||||||||||| ||||| |||||||||||||    
3646883 tcaatctggtaacctacccgcggagcgagtattgtgaacccgaaaacccttct 3646831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 191 - 243
Target Start/End: Complemental strand, 2344431 - 2344379
Alignment:
191 tcaatcgggtaacctacccctagagcgagtattatgaactcgaaaacccttct 243  Q
    |||||| ||||||||||||   ||||||||||| ||||| |||||||||||||    
2344431 tcaatctggtaacctacccgcggagcgagtattgtgaacccgaaaacccttct 2344379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University