View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18216_low_16 (Length: 238)
Name: NF18216_low_16
Description: NF18216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18216_low_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 112; Significance: 9e-57; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 32 - 155
Target Start/End: Complemental strand, 8963004 - 8962881
Alignment:
| Q |
32 |
aaaggttaacatttgtaatacatacaaagaaagtaatttatgtgcagatatattttctaatatgacttataaagatggtgtctctttgattatccatatg |
131 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
8963004 |
aaaggttaacatttgtaatatatacaaagaaagtaatttatgtgtagatatattttctaatatgacttataaagatggtttctctttgattatccatatg |
8962905 |
T |
 |
| Q |
132 |
caatgttttactcgagttaacttc |
155 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
8962904 |
caatgttttactcgagttaacttc |
8962881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 193 - 238
Target Start/End: Complemental strand, 8962844 - 8962799
Alignment:
| Q |
193 |
cctatgtaatcattgatcttgcattgtattttgacattcttgtagc |
238 |
Q |
| |
|
||||||||||| |||||||| |||| || ||||||||||||||||| |
|
|
| T |
8962844 |
cctatgtaatctttgatcttacattataatttgacattcttgtagc |
8962799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University