View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18216_low_17 (Length: 238)
Name: NF18216_low_17
Description: NF18216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18216_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 70 - 221
Target Start/End: Complemental strand, 8962726 - 8962576
Alignment:
| Q |
70 |
agttggtgtttctacacctcatctaattagaaatttattttttgttttggtttcgtccctcttattttgtnnnnnnnnnnnntatatataaccaccaata |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| | |||||||||| |||| |
|
|
| T |
8962726 |
agttggtgtttctacacctcatctaattagaaattaattttttgttttggtttcgtccctcttgttttg-caaaaagaaaaaaaaatataaccactaata |
8962628 |
T |
 |
| Q |
170 |
aacttgaacttagttattttttattaataaaaaattgttatcaaggcattct |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8962627 |
aacttgaacttagttattttttattaataaaaaattgttatcaacgcattct |
8962576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 8962795 - 8962753
Alignment:
| Q |
1 |
ttttgtgttttgagatgttttatgtataatatctttgcttttt |
43 |
Q |
| |
|
|||||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
8962795 |
ttttgttttttgagatgttttatgtttaatatctttgcttttt |
8962753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University