View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18216_low_18 (Length: 233)
Name: NF18216_low_18
Description: NF18216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18216_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 26 - 159
Target Start/End: Original strand, 37785121 - 37785254
Alignment:
| Q |
26 |
tctgaaatacttgttttttcagattttataatttaaattggtgaaaattacatttttccaccnnnnnnntagggggactcaattcggataatataatcca |
125 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||| ||||| |||||||| |||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
37785121 |
tctgaagtacttgttttttcggattttataatctaaatcggtgaaaaatacatttttccatcaaaaaaacagggggactcaattcggataatataatcca |
37785220 |
T |
 |
| Q |
126 |
aaaatagcaaaagcatattttgaaattcaatggg |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
37785221 |
aaaatagcaaaagcatattttgaaattcaatggg |
37785254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 149 - 214
Target Start/End: Original strand, 37787326 - 37787391
Alignment:
| Q |
149 |
aattcaatggggcgcgcaagaagagaatatgatgggaaatgtaattgctttattttagcttccaat |
214 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
37787326 |
aattcaatgggacgcgcaagaagagaatatgatgggaaacataattgctttattttagcttccaat |
37787391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University