View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18217_high_9 (Length: 236)
Name: NF18217_high_9
Description: NF18217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18217_high_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 12 - 219
Target Start/End: Original strand, 53205173 - 53205380
Alignment:
| Q |
12 |
cacagacccattcaagaaatctaatcccttatctcaagtataacatttttgtattttttacaagggttgggtggctaccctagtgacggatatttccttt |
111 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53205173 |
cacatacccagtcaagaaatctaatcccttatctcaagcataacatttttgtattttttacaagggttgggtggctaccctagtgacggatatttccttt |
53205272 |
T |
 |
| Q |
112 |
tctcgcttggagcaaattgagcagagagatacttccatttgatcttttaggatcatcacgtgcacccaacttccttgtgcccctgttcccctgaaaacca |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
53205273 |
tctcgcttggagcaaattgagcagagagatacttccatttgatcttttaggatcatcacgtgcacccaacttccttgtgcctctgttcccctgaaaacca |
53205372 |
T |
 |
| Q |
212 |
gacaaatg |
219 |
Q |
| |
|
|||||||| |
|
|
| T |
53205373 |
gacaaatg |
53205380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University