View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18217_low_13 (Length: 219)
Name: NF18217_low_13
Description: NF18217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18217_low_13 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 33969425 - 33969218
Alignment:
| Q |
1 |
atgcaaggtacttcaccctaattggaatgatttagaattattctaaactaatattacaagtaaccagctaaacaacaaaaaatccctcnnnnnnnnnnnn |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33969425 |
atgcaaggtacttcaccctaattggaataatttagaattattctaaaccaatattacaagtaaccagctaaacaacaaaaaatccctcaaaaaaaaaaaa |
33969326 |
T |
|
| Q |
101 |
g----ctaaacaacaaaaatatcataattctaataacatttatgtggttccaaatttaggacagtcacgattctgcaaagtaggtattatcaaaccgaaa |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33969325 |
aaaaactaaacaacaaaaatatcataattctaataacatttatgtggttccaaatttaggacagtcacgattctgcaaagtaggtattatcaaaccgaaa |
33969226 |
T |
|
| Q |
197 |
gttagctt |
204 |
Q |
| |
|
|||||||| |
|
|
| T |
33969225 |
gttagctt |
33969218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University