View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18217_low_9 (Length: 261)
Name: NF18217_low_9
Description: NF18217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18217_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 30 - 211
Target Start/End: Complemental strand, 36702546 - 36702367
Alignment:
| Q |
30 |
atgaacataactaaaaagaaacttacagtgaatcccttgcttgtaaatcctcatcaaacaaaactctaggaagtttgtccaagaattgcacggtcaaatc |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36702546 |
atgaacataactaaaaagaaacttacagtgaatcccttgcttgtaaatcctcatcaaacaaaactctaggaagtttgtccaagaattgcacggtcaaatc |
36702447 |
T |
 |
| Q |
130 |
caatcgacgaggctatagattattaacaagagacaactataagatgacttaattaatctatatatggtgcaaagaaataatt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36702446 |
caatcgacgaggctatagattattaacaagagacaactataagatgacttaattaatct--atatggtgcaaagaaataatt |
36702367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University