View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18219_high_18 (Length: 211)
Name: NF18219_high_18
Description: NF18219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18219_high_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 14 - 196
Target Start/End: Original strand, 48512872 - 48513054
Alignment:
| Q |
14 |
caaaggagatggaataaaaaaggttatcatggtttgattgtaatttttccgtaaattacattattaggccaacaatttgtaattaaccaagaatagatta |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48512872 |
caaaggagatggaataaaaaaggttatcatggtttgattgtaatttttccgtaaattacattattaggccaacaatttgtaattaaccaagaatagatta |
48512971 |
T |
|
| Q |
114 |
ctcagtctaggagattcacttgctgcttctattattatgcagctcatcttaggtatgtttactgttggcatttcagttgtatt |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
48512972 |
ctcagtctaggagattcacttgctgcttctattattatgcagctcatcttaggtatgtttattgttggcatttcagttgtatt |
48513054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University