View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18219_low_9 (Length: 396)
Name: NF18219_low_9
Description: NF18219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18219_low_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 83 - 380
Target Start/End: Original strand, 23589514 - 23589803
Alignment:
| Q |
83 |
gaccgctgctgatgatcaccctctcctgtgcttgtcgtgaacattacaacctttcggactgctgatctgctgatcaattatttattctcggctagatcca |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
23589514 |
gaccgctgctgatgatcaccctctcctgtgcttgtcgtgaacattaaaacctttcggactgc--------tgatcaattatttattctcggctagatccg |
23589605 |
T |
 |
| Q |
183 |
agaaattgtgaaataattattttgctttaaatattggaaatgatttgggatctcttgactccaagagtaactctgaaatgagtttctccgtttaatcgtt |
282 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
23589606 |
agaaattgtgaaatcatgattttgctttaaatattggaaatgattcgggatctcttgacttcaagagtaactctgaaatgagtttctccgttcaatcgtt |
23589705 |
T |
 |
| Q |
283 |
atgtacttggttctgtactttctatgcccttttaatgtttttgtgaaaatttaatcataatactctgatttaccttatgcacagtcggcttccatttt |
380 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
23589706 |
atgtacttggttctgtactttttatgcccttttaatgtttttgtgaaaatttaatcttaatactctgatttaccttatgcacagtcgacttccatttt |
23589803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University