View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18221_low_6 (Length: 233)
Name: NF18221_low_6
Description: NF18221
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18221_low_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 20 - 217
Target Start/End: Complemental strand, 22339627 - 22339430
Alignment:
| Q |
20 |
gaagttacctacaaagtaataaagaaacttgtagtagtacatgaaattaatgtagtgtgcatcattacatagtatgattaggcaaagaagatacaaactt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22339627 |
gaagttacctacaaagtaataaagaaacttgtagtagtacatgaaattaatgtagtgtgcatcattacatagtatgattaggcaaagaagatacaaactt |
22339528 |
T |
 |
| Q |
120 |
tttaattaccacaaagagttccttagctttcaaaggctccttatcttgaacaccatgataatctccttttgtaaaatgtcccacaactttcactctct |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22339527 |
tttaattaccacaaagagttccttagctttcaaaggctcgttatcttgaacaccatgataatctccttttgtaaaatgtcccacaactttcactctct |
22339430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University