View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18222_low_3 (Length: 402)
Name: NF18222_low_3
Description: NF18222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18222_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 357; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 357; E-Value: 0
Query Start/End: Original strand, 13 - 381
Target Start/End: Original strand, 27096669 - 27097037
Alignment:
| Q |
13 |
taggtatggggaccactagaccatgatggaccgtgtagataatgccacgtggaaaatagattccttgatcatagatgaattttggaaatacaactataga |
112 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27096669 |
taggtatggggaccactagagcatgatggaccgtgtagatgatgccacgtggaaaatagattccttgatcatagatgaattttggaaatacaactataga |
27096768 |
T |
 |
| Q |
113 |
gaagctgtgatgctgatgtgtatagccgacccaacattgtgccactgccaacgtagagacgcaaacaaagatccaaagtagcgtaagcatcaaacacttc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27096769 |
gaagctgtgatgctgatgtgtatagccgacccaacattgtgccactgccaacgtagagacgcaaacaaagatccaaagtagcgtaagcatcaaacacttc |
27096868 |
T |
 |
| Q |
213 |
acctctcccttttaatccaacgttccttattcattccttatacccaccacttttaatctccaccctccatttaactctaccatctatattttattcatcc |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
27096869 |
acctctcccttttaatccaacgttccttattcattccttatacccaccacttttaatctccaccctccatttaactctaccacctatattttattcatcc |
27096968 |
T |
 |
| Q |
313 |
tttgtcttcttagtcttaccttcttctgtcttgttcaattcttagttcatttcaatcctcgtttcttta |
381 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27096969 |
tttgtcttcttagtcttaccttcttctgtcttgttcaattcttagttcatttcaatcctcgtttcttta |
27097037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University