View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18222_low_4 (Length: 354)
Name: NF18222_low_4
Description: NF18222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18222_low_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 32 - 347
Target Start/End: Original strand, 27980625 - 27980942
Alignment:
| Q |
32 |
cgcttcaaaagtggatcgggaccccggtgatcttttttgtgannnnnnnnnn---aacaattcaatgggggtcaaagaacaataacaaacactaaatcgt |
128 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||| || |||| ||||||||| |||||||||| |
|
|
| T |
27980625 |
cgcttcaaaagtggatcgggaccccggtgctcttttttgtgatttttttttttttaacaattcaatgggg-tcgtagaataataacaaaaactaaatcgt |
27980723 |
T |
 |
| Q |
129 |
atcattatgtttgggatcaatggttaaaatgcaacaataaagagtgnnnnnnnnnnnnnnnnncagtagatgaaaaggagtgcatctcccctttactgta |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27980724 |
atcattatgtttgggatcaatggttaaaatgcaacaataaagagtgaaaaaataaaaataaaacagtagatgaaaacgagtgcatctcccctttactgta |
27980823 |
T |
 |
| Q |
229 |
tttagtgatctactttgacaaaattatgaattttttcttcactctcctttgcttgatttttcactctgatctaccctatttttagtccctctttccgtct |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27980824 |
tttagtgatctactttgacaaaattatgaattttttcttcactctcctttgcttgatttttcactctgatctaccctatttttagtccctctttccgtct |
27980923 |
T |
 |
| Q |
329 |
caaaaatcatccctctctg |
347 |
Q |
| |
|
|||||| |||||||||||| |
|
|
| T |
27980924 |
caaaaaccatccctctctg |
27980942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University