View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18223_high_9 (Length: 253)

Name: NF18223_high_9
Description: NF18223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18223_high_9
NF18223_high_9
[»] chr7 (1 HSPs)
chr7 (18-240)||(29455084-29455321)


Alignment Details
Target: chr7 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 29455321 - 29455084
Alignment:
18 atatttacattgctaaagaaaagtaaacagaaagaatttgtgggcttccttcnnnnnnnnnnn-------gaattcgtgggctgtaggcatgtggcagat 110  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||                  ||||||||||| ||| ||||||||||||||    
29455321 atatttacattgctaaagaaaagtaaacagaaagaattcgtgggcttccttcaaaaaaaaaaaaaaaagagaattcgtgggatgttggcatgtggcagat 29455222  T
111 taaagtaaagtagtgtcgatttgcagctacaatacaatataagctttttgtttagggcttcatcacgatttacaacgccgcaa-----ctcactgata-- 203  Q
    ||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||     ||||||| ||      
29455221 taaagtaaagtagtgtcgatttgcacct-caatacaatataagctttttgtttagggcttcatcacgatttacaacgccgcaactcaactcactgctatc 29455123  T
204 --tcacatggatatccaaacagccaagaagaataggcct 240  Q
      |||||||||||||||||||||||||||||||||||||    
29455122 actcacatggatatccaaacagccaagaagaataggcct 29455084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University