View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18224_high_9 (Length: 236)
Name: NF18224_high_9
Description: NF18224
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18224_high_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 49 - 204
Target Start/End: Complemental strand, 53446237 - 53446082
Alignment:
| Q |
49 |
gtaacaaagctagcaatgtgtggtggaactcaattcagcagcgtccaaatgaagtctccatggtaaccagacatacagtcctcaaatcattggtatcata |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53446237 |
gtaacaaagctagcaatgtgtggtggaactcaattcagcagcgtccaaataaagtctccatggtaaccagacatacagtcctcaaatcattggtatcata |
53446138 |
T |
 |
| Q |
149 |
ttcatcatcattcaatttcaattttagtccacctagttttatggtgcatgcctgca |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53446137 |
ttcatcatcattcaatttcaattttagtccacctagttttatggtgcatgcctgca |
53446082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 32
Target Start/End: Complemental strand, 45645265 - 45645234
Alignment:
| Q |
1 |
taatatatgtaaggtctaaagttcaaacctca |
32 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
45645265 |
taatatatgtaaggtctaaagttcaaacctca |
45645234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University