View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18226_high_4 (Length: 438)
Name: NF18226_high_4
Description: NF18226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18226_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 97; Significance: 2e-47; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 1 - 136
Target Start/End: Complemental strand, 41405462 - 41405329
Alignment:
| Q |
1 |
taacctctaacaataacaggtgaggatctttttatttttcaaattaagcaaatgaaaggttttatttaaagagagagnnnnnnnnnncgagaaaaatagt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
41405462 |
taacctctaacaataacaggtgaggatctttttatttttcaaattaagcaaatgaaaggttttatttaaagagagag--aaaaaaaacgagaaaaatagt |
41405365 |
T |
 |
| Q |
101 |
gatggtgagataatttggtgatggatcaactattta |
136 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |
|
|
| T |
41405364 |
gatggtgagataatttggtgatgaatcaactattta |
41405329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University