View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18226_low_14 (Length: 240)
Name: NF18226_low_14
Description: NF18226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18226_low_14 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 18 - 240
Target Start/End: Original strand, 52366392 - 52366618
Alignment:
| Q |
18 |
ataactttatgaaggaatgacaagatagctatctttaatgcaaacagcttttgatatatatgagcttttatgaagcaaaaacaaataaaagtaaataatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
52366392 |
ataactttatgaaggaatgacaagatagctatctttaatgcaaacagcttttgatatatatgagcttttatgaagcaaaaacaaataaaattaaataatt |
52366491 |
T |
|
| Q |
118 |
ggtttattttttcttctcaatac---tattgcc-aaaatatgagtttgtatattactatactgacttctaaattgttaagttgtcattactttctcacac |
213 |
Q |
| |
|
||||||||||||||||||||||| ||||||| ||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
52366492 |
ggtttattttttcttctcaatactattattgccaaaaatatgagtttgtatattattatactgacttctaaattgttaagttttcattactttctcacac |
52366591 |
T |
|
| Q |
214 |
attaagaatgaatttcataaaaagtgg |
240 |
Q |
| |
|
||||||||||||||||||| ||||||| |
|
|
| T |
52366592 |
attaagaatgaatttcatataaagtgg |
52366618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University