View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18226_low_7 (Length: 377)
Name: NF18226_low_7
Description: NF18226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18226_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 89; Significance: 8e-43; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 10 - 105
Target Start/End: Complemental strand, 33817041 - 33816945
Alignment:
| Q |
10 |
attattcttagtaaa-catcgcattctttgttgttgaccgaaccaactatttttctaaaaatgatgggttgcttataccttatcaatgcatcatttt |
105 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33817041 |
attattcttagtaaaacatcgcattctttgttgttgaccgaaccaactatttttctaaaaatgatgggttgcttataccttatcaatgcatcatttt |
33816945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 168 - 229
Target Start/End: Complemental strand, 33816879 - 33816818
Alignment:
| Q |
168 |
gattgaacaacttgagtttcaaaagtacatgtttttgtactaggaacaagatataagaacaa |
229 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33816879 |
gattgaacaacttgactttcaaaagtgcatgtttttgtactaggaacaagatataagaacaa |
33816818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 295 - 359
Target Start/End: Complemental strand, 33816752 - 33816684
Alignment:
| Q |
295 |
acttcttaaaaactatcacac----atagctacatatttattattttgaccgcatatatatgaaattac |
359 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33816752 |
acttcttaaaaactatcacacgtacatagctacatatttattattttgaccgcatatatatgaaattac |
33816684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University