View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18227_high_39 (Length: 241)
Name: NF18227_high_39
Description: NF18227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18227_high_39 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 14 - 158
Target Start/End: Complemental strand, 37892215 - 37892071
Alignment:
| Q |
14 |
cagatctcaaagagataaatttcacttccaccccaccaccccagaagttaaaaagcaaatattaacacaagtttcataaaaaagacagaatttttaagct |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37892215 |
cagatctcaaagagataaatttcacttccaccccaccaccccagaagttaaaaagcaaatattaacacaagtttcataaaaaagacagaatttttaagct |
37892116 |
T |
 |
| Q |
114 |
ttttcagctgcaaaaactttgaaactgccctgaaccctctcaccc |
158 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
37892115 |
ttttcagctgcaaaaactttgaaactaccctgaaccctctcaccc |
37892071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University