View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18227_low_34 (Length: 279)
Name: NF18227_low_34
Description: NF18227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18227_low_34 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 7 - 262
Target Start/End: Complemental strand, 33169529 - 33169277
Alignment:
| Q |
7 |
atatgaaaataagcggtgagactagttgataacatggctacccctgttaaaatatgagtggcctcatttatttgtcttcttttaaatcaaccttaaagtt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33169529 |
atatgaaaataagcggtgagactagttgataacatggctacccctgttaaaatatgagtggcctcatttgtttgtcttcttttaaatcaaccttaaagtt |
33169430 |
T |
|
| Q |
107 |
tgtaaactgagcggcaaagaacttcctacaaattgtgataacataaccaagttctataacatcaatctgattcagt-aaggcatttgttggggttttgca |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33169429 |
tgtaaactgagcggcaaagaacttcctacaaattgtgataacataaccaagttctataacatcaatctgattcagtgaaggcatttgttggggttttgca |
33169330 |
T |
|
| Q |
206 |
atcaagcacgaaatcaatattatcaaattgcatgcatatcactggtccattgaagcg |
262 |
Q |
| |
|
|||||||| |||||||| |||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
33169329 |
atcaagcatgaaatcaacattatcaaat----tgcatatcactagtccattgaagcg |
33169277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University