View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18227_low_37 (Length: 264)
Name: NF18227_low_37
Description: NF18227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18227_low_37 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 1 - 249
Target Start/End: Complemental strand, 33169067 - 33168818
Alignment:
| Q |
1 |
cttgttggtgtagaagtaaaaggcatcgccgttaagactgtcatgctttgtgt-atccatgcaggaatgtcgtgaggttgatgtcaagagcagctgtcgt |
99 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33169067 |
cttgttggtatagaagtaaaaggcatcgccgttaagactgtcatgctttgtgtgatccgtgcaggaatgtcgtgaggttgatgtcaagagcagctgtcgt |
33168968 |
T |
 |
| Q |
100 |
agagcatttgccagcgtccattcctcttatcaaatgatgggcgcgctctaccacttgcgcgcatagctcattaacatcgtgccatggtttaagattcccg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33168967 |
agagcatttgccagcgtccattcctcttatcaaatgatgggcgcactctaccacttgcgcgcatagctcattaacatcgtgccatggtttaagattcccg |
33168868 |
T |
 |
| Q |
200 |
tgttgtagtaataagaagacggcttctgatgtcgaaggagtggtaagaac |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
33168867 |
tgttgtagtaataagaagacggcttctgatgtcgaagtagtggtaagaac |
33168818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 143 - 192
Target Start/End: Complemental strand, 22956330 - 22956281
Alignment:
| Q |
143 |
cgctctaccacttgcgcgcatagctcattaacatcgtgccatggtttaag |
192 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||| ||||||| |||||| |
|
|
| T |
22956330 |
cgctctaccacttgtgtgcatagctcattaacatcttgccatgatttaag |
22956281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University