View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18227_low_48 (Length: 225)
Name: NF18227_low_48
Description: NF18227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18227_low_48 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 18 - 209
Target Start/End: Original strand, 9358412 - 9358604
Alignment:
| Q |
18 |
atattgatgatagtgaattagtgataactttttccccctcatcttcggtctcttttttcttcttttgaaagcaaaa-gcagttttcactttgcacaaaca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9358412 |
atattgatgatagtgaattagtgataactttttccccctcatcttcggtctcttttttcttcttttgaaagcaaaaagcagttttcactttgcacaaaca |
9358511 |
T |
 |
| Q |
117 |
accaaacatatttttgtatctttgttcaaaccccaagaaacagcaataaattaaaataaaaggacacctgcccaaaaacataacaagaaatgt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9358512 |
accaaacatatttttgtatctttgttcaaaccccaagaaacagcaataaattaaaataaaaggacacctgcccaaaaacataacaagaaatgt |
9358604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 72 - 129
Target Start/End: Original strand, 9342883 - 9342940
Alignment:
| Q |
72 |
ttttcttcttttgaaagcaaaagcagttttcactttgcacaaacaaccaaacatattt |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
9342883 |
ttttcttcttttgaaagcaaaagcagttttcattttgcacaaacaaccaaacatattt |
9342940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University