View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18228_high_17 (Length: 241)
Name: NF18228_high_17
Description: NF18228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18228_high_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 13 - 227
Target Start/End: Original strand, 42658825 - 42659039
Alignment:
| Q |
13 |
tgagaagaattgggatgtcatagtggtcgatggaccgagtggcgattcgaccgagtcacctggtagaatggcatccatttacactgctggtgttctagct |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
42658825 |
tgagaagaattgggatgtcatagtggtcgatggaccgagtggcctttcgaccgagtcacctggtagaatggcatccatttacactgctagtgttctagct |
42658924 |
T |
 |
| Q |
113 |
agaggtgggaatggttcagatgtacttgtacatgacgtagatcgaatgatagagaagtggttttcttgggagtttctttgtgatgagaatttgttgtatt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42658925 |
agaggtgggaatggttcagatgtacttgtacatgatgtagatcgaatgatagaaaaatggttttcttgggagtttctttgtgatgagaatttgttgtatt |
42659024 |
T |
 |
| Q |
213 |
ctaaagggaaattat |
227 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
42659025 |
ctaaagggaaattat |
42659039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University