View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18228_low_19 (Length: 326)
Name: NF18228_low_19
Description: NF18228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18228_low_19 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 170; Significance: 3e-91; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 107 - 292
Target Start/End: Original strand, 32195338 - 32195523
Alignment:
| Q |
107 |
atttggactaataatttgactagtgtatacaagtacaatggtgactagcacatatgacaataagtccaggtggacaatgacgattttggatagtacaatc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32195338 |
atttggactaataatttgactagtgtatacaagtacaatggtgactagcacatatgacaataagtccaggtggacaatgacgattttggatagtacaatc |
32195437 |
T |
 |
| Q |
207 |
ctcagctgtgttgcaacttgactccaactcctcactcattcttgtgccttgtgaagcttctgatttcatacacatatctacatgaa |
292 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||| ||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32195438 |
ctcagctgtgttgcaacttgagtccaacttctcagtcattcttgtggcttgtgaagcttctgatttcatacacatatctacatgaa |
32195523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 109 - 186
Target Start/End: Original strand, 32202467 - 32202544
Alignment:
| Q |
109 |
ttggactaataatttgactagtgtatacaagtacaatggtgactagcacatatgacaataagtccaggtggacaatga |
186 |
Q |
| |
|
||||||||| ||||| ||||||| ||||| | ||||||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
32202467 |
ttggactaacaattttactagtggatacatgaacaatggtggacagcacatatgacaataagtccagatggacaatga |
32202544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 48 - 109
Target Start/End: Original strand, 32195233 - 32195302
Alignment:
| Q |
48 |
atataatagatgatgcaatcaccctttctta--------ttatgtattattgacgtcaaacacaacaatt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||| || ||||||||||||||||| ||||||||||||| |
|
|
| T |
32195233 |
atataatagatgatgcaatcaccctttcatattatcattttatgtattattgacgtgaaacacaacaatt |
32195302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University