View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18229_low_8 (Length: 238)

Name: NF18229_low_8
Description: NF18229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18229_low_8
NF18229_low_8
[»] chr7 (2 HSPs)
chr7 (1-228)||(38883883-38884110)
chr7 (1-224)||(38893075-38893298)
[»] chr3 (1 HSPs)
chr3 (97-210)||(37315993-37316106)
[»] chr1 (1 HSPs)
chr1 (124-218)||(33115133-33115227)


Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 38883883 - 38884110
Alignment:
1 tttacagatgcctatgatctgttctgtgtatcccttgttacaaagttgctcggtcgcatatactaccacgttgatggtgctgcgaagcccggtacattgc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38883883 tttacagatgcctatgatctgttctgtgtatcccttgttacaaagttgctcggtcgcatatactaccacgttgatggtgctgcgaagcccggtacattgc 38883982  T
101 ctcccaatgtatcagctgctgtgaatggtgtagctttctgtggaacactttcagggcaacttttctttggctggcttggtgataagatgggcaggaaaaa 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38883983 ctcccaatgtatcagctgctgtgaatggtgtagctttctgtggaacactttcagggcaacttttctttggctggcttggtgataagatgggcaggaaaaa 38884082  T
201 agtctatggtatgaccctcatgatgatg 228  Q
    ||||||||||||||||||||||||||||    
38884083 agtctatggtatgaccctcatgatgatg 38884110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 38893075 - 38893298
Alignment:
1 tttacagatgcctatgatctgttctgtgtatcccttgttacaaagttgctcggtcgcatatactaccacgttgatggtgctgcgaagcccggtacattgc 100  Q
    ||||| ||||||||||||||||||||  ||||||||||||| |||||||| || |||||||| ||||| ||||||||||| | |||||||||||||||||    
38893075 tttactgatgcctatgatctgttctgcatatcccttgttaccaagttgctgggacgcatatattaccatgttgatggtgccgggaagcccggtacattgc 38893174  T
101 ctcccaatgtatcagctgctgtgaatggtgtagctttctgtggaacactttcagggcaacttttctttggctggcttggtgataagatgggcaggaaaaa 200  Q
    | ||||||||||||||||| || ||||| || ||||||||||| |||||| ||||||| ||||||||||||||||||||||||||| |||| ||||| ||    
38893175 cacccaatgtatcagctgcggttaatggggttgctttctgtggtacacttacagggcagcttttctttggctggcttggtgataagttgggtaggaagaa 38893274  T
201 agtctatggtatgaccctcatgat 224  Q
    ||| ||||||||||| || |||||    
38893275 agtgtatggtatgacactgatgat 38893298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 97 - 210
Target Start/End: Complemental strand, 37316106 - 37315993
Alignment:
97 ttgcctcccaatgtatcagctgctgtgaatggtgtagctttctgtggaacactttcagggcaacttttctttggctggcttggtgataagatgggcagga 196  Q
    |||||||| ||||||||||| || || |||||||| ||| ||||||| || ||  |||| |||||||||||||| |||||||| || || ||||| || |    
37316106 ttgcctccaaatgtatcagcagcagtaaatggtgttgctctctgtggcactctagcaggccaacttttctttggttggcttggggacaaaatgggaagaa 37316007  T
197 aaaaagtctatggt 210  Q
    ||||||| ||||||    
37316006 aaaaagtttatggt 37315993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 124 - 218
Target Start/End: Original strand, 33115133 - 33115227
Alignment:
124 aatggtgtagctttctgtggaacactttcagggcaacttttctttggctggcttggtgataagatgggcaggaaaaaagtctatggtatgaccct 218  Q
    |||||||| |||||| ||||| ||||  |||| |||||||||||||| ||||||||||| || ||||| || |||  ||| ||||| ||||||||    
33115133 aatggtgttgctttcagtggagcactggcaggacaacttttctttggttggcttggtgacaaaatgggaagaaaacgagtttatggaatgaccct 33115227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University