View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18230_low_4 (Length: 252)
Name: NF18230_low_4
Description: NF18230
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18230_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 27908175 - 27908412
Alignment:
| Q |
1 |
aacaagatgcagatcttcgtcaaaactttgaccggaaagaccatcactctcgaggttgagagtagcgacaccatcgacaacgtcaaggccaagatccagg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27908175 |
aacaagatgcagatcttcgtcaaaactttgaccggaaagactatcactctcgaggttgagagtagcgacaccatcgacaacgtcaaggccaagatccagg |
27908274 |
T |
|
| Q |
101 |
ttagttagggtttcttatgatcgctgattttgttacttttaattttgcttactcgatttattttaagggttttattaaaa-ttcgtgtctgctaggtttt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
27908275 |
ttagttagggtttcttatgatcgctgattttgttacttttaattttgcttactcgatttattttaagggttttattaaaatttcgtgtctgctaggtttt |
27908374 |
T |
|
| Q |
200 |
acaattgaaattatttgtgaaaattctactgataaaac |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
27908375 |
acaattgaaattatttgtgaaaattctactaataaaac |
27908412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 5 - 98
Target Start/End: Complemental strand, 31306682 - 31306589
Alignment:
| Q |
5 |
agatgcagatcttcgtcaaaactttgaccggaaagaccatcactctcgaggttgagagtagcgacaccatcgacaacgtcaaggccaagatcca |
98 |
Q |
| |
|
||||||||||||| || ||||| ||||| ||||| ||||||||||| ||||| |||||| ||| || || || || ||||||||||||||||| |
|
|
| T |
31306682 |
agatgcagatctttgtgaaaacattgacaggaaaaaccatcactcttgaggtagagagttccgatacaattgataatgtcaaggccaagatcca |
31306589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 4 - 106
Target Start/End: Complemental strand, 40493184 - 40493082
Alignment:
| Q |
4 |
aagatgcagatcttcgtcaaaactttgaccggaaagaccatcactctcgaggttgagagtagcgacaccatcgacaacgtcaaggccaagatccaggtta |
103 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||| ||||| |||||||||||||| |||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
40493184 |
aagatgcagatcttcgtgaagactttgaccggaaagactatcaccctcgaggttgagagcagcgacacaatcgacaacgtcaaggccaagatccaggtta |
40493085 |
T |
|
| Q |
104 |
gtt |
106 |
Q |
| |
|
||| |
|
|
| T |
40493084 |
gtt |
40493082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 56; Significance: 3e-23; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 5 - 100
Target Start/End: Original strand, 33772936 - 33773031
Alignment:
| Q |
5 |
agatgcagatcttcgtcaaaactttgaccggaaagaccatcactctcgaggttgagagtagcgacaccatcgacaacgtcaaggccaagatccagg |
100 |
Q |
| |
|
||||||| |||||||| ||||| | || |||||||||||||||||||||||||||||| |||||||||||||||||| ||||| |||||||||| |
|
|
| T |
33772936 |
agatgcaaatcttcgtgaaaaccctcactggaaagaccatcactctcgaggttgagagttccgacaccatcgacaacgttaaggctaagatccagg |
33773031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 7 - 100
Target Start/End: Original strand, 33774972 - 33775065
Alignment:
| Q |
7 |
atgcagatcttcgtcaaaactttgaccggaaagaccatcactctcgaggttgagagtagcgacaccatcgacaacgtcaaggccaagatccagg |
100 |
Q |
| |
|
|||||||||||||| || || | ||||| ||||||| ||| || ||||| || || ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33774972 |
atgcagatcttcgttaagaccctcaccggcaagaccaccacccttgaggtcgaaagctccgacaccatcgacaacgtcaaagccaagatccagg |
33775065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 3 - 100
Target Start/End: Original strand, 36459855 - 36459952
Alignment:
| Q |
3 |
caagatgcagatcttcgtcaaaactttgaccggaaagaccatcactctcgaggttgagagtagcgacaccatcgacaacgtcaaggccaagatccagg |
100 |
Q |
| |
|
|||||||||||||||||| ||||| | || || ||||| || || |||||||||||| | |||||| |||||||| ||||| ||||||||||||| |
|
|
| T |
36459855 |
caagatgcagatcttcgtgaaaaccctaacagggaagacgataaccctcgaggttgagtcttccgacacaatcgacaatgtcaaagccaagatccagg |
36459952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 7 - 92
Target Start/End: Complemental strand, 42609768 - 42609683
Alignment:
| Q |
7 |
atgcagatcttcgtcaaaactttgaccggaaagaccatcactctcgaggttgagagtagcgacaccatcgacaacgtcaaggccaa |
92 |
Q |
| |
|
|||||||||||||| ||||| | ||||| || |||||||| |||||||||||||| || ||||| |||||||| ||||||||||| |
|
|
| T |
42609768 |
atgcagatcttcgtgaaaaccctaaccgggaaaaccatcaccctcgaggttgagagcagtgacacaatcgacaatgtcaaggccaa |
42609683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 7 - 95
Target Start/End: Original strand, 25948399 - 25948487
Alignment:
| Q |
7 |
atgcagatcttcgtcaaaactttgaccggaaagaccatcactctcgaggttgagagtagcgacaccatcgacaacgtcaaggccaagat |
95 |
Q |
| |
|
|||||||| ||||| ||||| | || || ||||| || |||||||| || |||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
25948399 |
atgcagatattcgtgaaaaccctaacagggaagacaattactctcgaagtcgagagtagtgacaccatcgacaatgtcaaagccaagat |
25948487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University