View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18231_high_6 (Length: 399)
Name: NF18231_high_6
Description: NF18231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18231_high_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 123; Significance: 4e-63; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 200 - 326
Target Start/End: Original strand, 45747320 - 45747446
Alignment:
| Q |
200 |
gatataagattgagcatacagttgagaagaaagtagatggattttgcattgaactagaaaagggtatagaaatatcagtgacaagtcttgcaaccttaca |
299 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45747320 |
gatataagattaagcatacagttgagaagaaagtagatggattttgcattgaactagaaaagggtatagaaatatcagtgacaagtcttgcaaccttaca |
45747419 |
T |
|
| Q |
300 |
ggaactgttcacactctcaaaccccat |
326 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
45747420 |
ggaactgttcacactctcaaaccccat |
45747446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 18 - 110
Target Start/End: Original strand, 45747138 - 45747230
Alignment:
| Q |
18 |
ctcccaagcagaccagtatctaaactatcaccagtgagaccaatctcactctgcccctccatttttctttgctgtagaaaacaatctcatcag |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45747138 |
ctcccaagcagaccagtatctaaactatcaccagtgagaccaatctcactctgcccctccatttttctttgctgtagaaaacaatctcatcag |
45747230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 348 - 384
Target Start/End: Original strand, 45747470 - 45747506
Alignment:
| Q |
348 |
ctctcctaaaacttgtctgagaagaatactactctct |
384 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45747470 |
ctctcctaaaacttgtctgagaagaatactactctct |
45747506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 53; Significance: 3e-21; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 18 - 74
Target Start/End: Original strand, 6613771 - 6613827
Alignment:
| Q |
18 |
ctcccaagcagaccagtatctaaactatcaccagtgagaccaatctcactctgcccc |
74 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6613771 |
ctcccaagcagaccagtatctaaactatcactagtgagaccaatctcactctgcccc |
6613827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University