View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18231_low_9 (Length: 336)
Name: NF18231_low_9
Description: NF18231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18231_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 11 - 313
Target Start/End: Original strand, 35043647 - 35043949
Alignment:
| Q |
11 |
ggtagataattctatcatcttttatgcatgcttcaattatttttcaaaattattgggctggcccctgcatatgtgttttctctgccggcagatagtgctc |
110 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35043647 |
ggtatataattctatcatcttttgtgcatgcttcaattatttttcaaaattattgggctggcccctgcatatgtgttttctctgctggcagatagtgctc |
35043746 |
T |
 |
| Q |
111 |
ctccatcccttttatatacgttcaaatctacacctgcagagaaaccaacatcacacattacactacaccgctagctatagtactccatttctaacaccaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35043747 |
ctccatcccttttatatacgttcaaatctacacctgcagagaaaccaacatcacacattacactacaccgctagctatagtactccatttctaacaccaa |
35043846 |
T |
 |
| Q |
211 |
gcaaatgatgaataatttgctttcaccttcgacccttcaaccatttactatttgcaccactttgttgtttcttttcgttctcttttggctactgagaagc |
310 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35043847 |
gcaaatgatgaataatttgctttcaccctcgacccttcaaccatttactatttgcaccactttgttgtttcttttcgttctcttttggctactgagaagc |
35043946 |
T |
 |
| Q |
311 |
cgc |
313 |
Q |
| |
|
||| |
|
|
| T |
35043947 |
cgc |
35043949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University