View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18232_high_24 (Length: 279)
Name: NF18232_high_24
Description: NF18232
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18232_high_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 1 - 271
Target Start/End: Original strand, 41132929 - 41133199
Alignment:
| Q |
1 |
ttgaaatgccaaactcaatgtcacgctccaacccacctgcatatcacatataattaatttgtcaagaggaaaatattaattcttacatacaatactatat |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41132929 |
ttgaaatgccaaagtcaatgtcacgctccaacccacctgcatgtcacatataattaatttgtcaagaggaaaatattaattcttacatacaatactatat |
41133028 |
T |
 |
| Q |
101 |
atgaaatatatatgcatgaagaccttggaattgtggtttgcattcatagaaactcttccagcttctaaattgagggagtctacacgacgtagttttgccc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41133029 |
atgaaatatatatgcatgaagaccttggaattgtggtttgcattcatagaaactcttccagcttctaaattgagggagtctacacgacgtagttttgccc |
41133128 |
T |
 |
| Q |
201 |
atgacacctttcgatctttcagctttttctccgtaatctcctttgttgtttctgtctcatcctctctgctc |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41133129 |
atgacacctttcgatctttcagctttttctccgtaatctcctttgttgtttctgtctcatcctctatgctc |
41133199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University