View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18234_high_17 (Length: 321)
Name: NF18234_high_17
Description: NF18234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18234_high_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 105; Significance: 2e-52; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 1 - 174
Target Start/End: Complemental strand, 5689803 - 5689624
Alignment:
| Q |
1 |
tttgttggtggtttttgttt-ttgtttagtggagaaataataagtggtttgatg---gattttgtaatggagatttttctttttgcataatgcttggaat |
96 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
5689803 |
tttgttggtggtttttgtttcttgtttagtggagaaataataagtggtttgatgattgattttgtaatggagatttttctttttgcataatgcttggtat |
5689704 |
T |
|
| Q |
97 |
gagtagttgtttgaatatgacaagg-nnnnnnntgatgcaaaagtaccttatggttgtcatcattg-ttttggaccataa |
174 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| | ||||||||||||||| |||||||||||| |
|
|
| T |
5689703 |
gagtagttgtttgaatatgacaaggaaaaaaaatgatgcaaaagtaccatgtggttgtcatcattgaatttggaccataa |
5689624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University