View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18234_high_26 (Length: 249)
Name: NF18234_high_26
Description: NF18234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18234_high_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 44; Significance: 4e-16; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 166 - 221
Target Start/End: Original strand, 27336206 - 27336261
Alignment:
| Q |
166 |
tgattaaactacaccttccaaagcaattcataagatcaacacaacactcgtagtat |
221 |
Q |
| |
|
||||||||||||| ||||||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
27336206 |
tgattaaactacagcttccaaagtaattcataagatcaacacaccactcgtagtat |
27336261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 40 - 76
Target Start/End: Original strand, 27336062 - 27336098
Alignment:
| Q |
40 |
atagtttttatttgaagtagtaaagaagaaatcataa |
76 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27336062 |
atagtttttatttgaagtagtaaagaagaaatcataa |
27336098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University