View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18234_high_30 (Length: 228)
Name: NF18234_high_30
Description: NF18234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18234_high_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 65 - 209
Target Start/End: Original strand, 15323326 - 15323471
Alignment:
| Q |
65 |
ggattggacaaacttgaaaggcaaacaacc-aaggatggtactggttcaaattatgagaattctaaaccataatttaaagttaaattagacatttggtcg |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15323326 |
ggattggacaaacttgaaaggcaaacaacctaaggatggtactggttcaaattatgagaattctaaaccataatttaaagttaaattagacatttggtcg |
15323425 |
T |
 |
| Q |
164 |
cttaattaatttgtgtgtttccttcataactcctaaaatcttacat |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
15323426 |
cttaattaatttgtgtgtttccttcataactcctaaaatcgtacat |
15323471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University