View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18234_low_23 (Length: 267)
Name: NF18234_low_23
Description: NF18234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18234_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 78 - 253
Target Start/End: Complemental strand, 52716102 - 52715921
Alignment:
| Q |
78 |
gagagtttgtgtataaattt-atttaagaaggaaacatggctgagaa---aggtttgattctgtattgttaagtcttctcttatagagggtgacacct-- |
171 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52716102 |
gagagtttgtgtataaattttatttaagaaggaaacatggctgagaagaaaggtttaattctgtattgttaagtcttctcttatagagggtgacacctct |
52716003 |
T |
 |
| Q |
172 |
atgtttataattaaatgagatttataaagtttataataaaaaatggaagttcaaatgtagacagaagagggttggatattct |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
52716002 |
atgtttataattaaatgagatttataaagtttataataaaaaatggaagttcaaatgtagacagaagagggttggattttct |
52715921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University