View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18234_low_31 (Length: 237)

Name: NF18234_low_31
Description: NF18234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18234_low_31
NF18234_low_31
[»] chr2 (1 HSPs)
chr2 (11-218)||(32459836-32460044)


Alignment Details
Target: chr2 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 11 - 218
Target Start/End: Original strand, 32459836 - 32460044
Alignment:
11 catagggagcataacctataaatttcaatgatcaatatgaatttagattgtctgtagtcaaaatatcgtacagtaatttcattttgagatcacaacggtt 110  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||| ||||||||    
32459836 catagggagcataatctataaatttcaatgatcaatatgaatttagatcgtctgtagtcaaaatatcgtacaataatttcattttgagatcccaacggtt 32459935  T
111 gaattaagattagatatgtcatatttcgatttcatcaaacc-atatttcaaatgttttgattcgtaataataacagtctaatcttaattcattggtcgaa 209  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
32459936 gaattaagattagatatgtcatatttcgatttcatcaaaccaatatttcaaatgttttgattcgtaataataacagtctaatcttaattcattggtcgag 32460035  T
210 atgtgttgt 218  Q
    |||||||||    
32460036 atgtgttgt 32460044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University