View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18234_low_31 (Length: 237)
Name: NF18234_low_31
Description: NF18234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18234_low_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 11 - 218
Target Start/End: Original strand, 32459836 - 32460044
Alignment:
| Q |
11 |
catagggagcataacctataaatttcaatgatcaatatgaatttagattgtctgtagtcaaaatatcgtacagtaatttcattttgagatcacaacggtt |
110 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
32459836 |
catagggagcataatctataaatttcaatgatcaatatgaatttagatcgtctgtagtcaaaatatcgtacaataatttcattttgagatcccaacggtt |
32459935 |
T |
 |
| Q |
111 |
gaattaagattagatatgtcatatttcgatttcatcaaacc-atatttcaaatgttttgattcgtaataataacagtctaatcttaattcattggtcgaa |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32459936 |
gaattaagattagatatgtcatatttcgatttcatcaaaccaatatttcaaatgttttgattcgtaataataacagtctaatcttaattcattggtcgag |
32460035 |
T |
 |
| Q |
210 |
atgtgttgt |
218 |
Q |
| |
|
||||||||| |
|
|
| T |
32460036 |
atgtgttgt |
32460044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University