View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18234_low_38 (Length: 205)
Name: NF18234_low_38
Description: NF18234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18234_low_38 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 82; Significance: 6e-39; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 82; E-Value: 6e-39
Query Start/End: Original strand, 108 - 189
Target Start/End: Complemental strand, 44466704 - 44466623
Alignment:
| Q |
108 |
ggtaatattgtcattattgagtttccaatccttcacttgtcgacattttaaatagaagcatgtttcttgtatactgaatatt |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44466704 |
ggtaatattgtcattattgagtttccaatccttcacttgtcgacattttaaatagaagcatgtttcttgtatactgaatatt |
44466623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 17 - 62
Target Start/End: Complemental strand, 44466795 - 44466750
Alignment:
| Q |
17 |
actatgctgccctcttcccctcaacaaaaagaaaatatgaactagg |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44466795 |
actatgctgccctcttcccctcaacaaaaagaaaatatgaactagg |
44466750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University