View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18235_low_14 (Length: 256)
Name: NF18235_low_14
Description: NF18235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18235_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 19 - 244
Target Start/End: Original strand, 38511382 - 38511607
Alignment:
| Q |
19 |
caaaattccaaagaaatttgtataccttgtgaactttgctatttgtgttcctttggctgttaaactgattcacttccttcaaggttgtgcaatgagtgaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
38511382 |
caaaattccaaagaaatttgtataccttgtgaactttgctatttgtgttcctttggctgttaaactgattcacttccttcaaggttgtgcattgagtgaa |
38511481 |
T |
 |
| Q |
119 |
gggtataacaaatgcataaaatgaaacaataacaaagcacactgacttgtaagaaatgtgcattctcctagcacaataactcagcaacacaaaactacaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38511482 |
gggtataacaaatgcataaaatgaaacaataacaaagcacgctgacttgtaagaaatgtgcattctcctagcacaataactcagcaacacaaaactacaa |
38511581 |
T |
 |
| Q |
219 |
ggtactgattactatttactaccctt |
244 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
38511582 |
ggtactgattactatttactaccctt |
38511607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University