View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18236_high_5 (Length: 629)
Name: NF18236_high_5
Description: NF18236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18236_high_5 |
 | |
|
| [»] scaffold0649 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0649 (Bit Score: 548; Significance: 0; HSPs: 1)
Name: scaffold0649
Description:
Target: scaffold0649; HSP #1
Raw Score: 548; E-Value: 0
Query Start/End: Original strand, 20 - 619
Target Start/End: Original strand, 4812 - 5411
Alignment:
| Q |
20 |
tatggatcatcctgatcactaccaattcgtggaccggggatgtaacggatttgttggttcatgcaatggattgatatgcatgctcagtgatcgcatcgat |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4812 |
tatggatcatcctgatcactaccaattcgtggaccggggatgtaacggatttgttggttcatgcaatggattgatatgcatgctcagtgatcgtatcgat |
4911 |
T |
|
| Q |
120 |
ggtaagtatcaaagctcttgcctccgtttctggaacccggccacgaggtcagcatcgaaaagactcggctattcttacgttgagcttagggttaaacatc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4912 |
ggtaagtatcaaagctcttgcctccgtttctggaacccggccacgaggtcagtatcgaaaagactcggctattcttacgttgagcttagggttagacatc |
5011 |
T |
|
| Q |
220 |
tctatttaaaattttcgtttggttatgataacacaaccggaaaatataaggtggtggcttatagtcccggtattgcaaaagtgtttagtttaggtgatca |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5012 |
tctatttaaaattttcgtttggttatgataacacaaccggaaaatataaggttgtggcctatagtcccggtattgcgaaagtgtttagtttaggtgatca |
5111 |
T |
|
| Q |
320 |
tgtttggaagagtattgaaagtttcccatcgactccttttcgttgcactcgttccgctcagactggtttggatcagaatggtggtgtctattttagcaac |
419 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
5112 |
tgtttggaagagtattgaaagtttcccttcgactccttttcgttgcactcgttctgctcggactggtttggatcagaatggtggtgtctattttagtaac |
5211 |
T |
|
| Q |
420 |
agtcttaattggtttaccctttgcaataacattgtttatctttactcggattggaaagatcttaacgatacgattgaacaatttggcattatctcgcttg |
519 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5212 |
agtcttaattggtttaccctttgcaataacattgtttatctttactcggattggaaagatcttaacgatacgattgaacaatttggcattatctcgcttg |
5311 |
T |
|
| Q |
520 |
atttggggacggacgaatgcacacagttgctcgtacctctagattttgctgaaataccaccgattatgccaattgtttgcgtattggcagattgcctttg |
619 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5312 |
atttggggacggaggaatgcacacagttgctcgtacctctagattttgatgaaataccacctattatgccaattgtttgcgtattggcagattgcctttg |
5411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000004; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 20967359 - 20967415
Alignment:
| Q |
221 |
ctatttaaaattttcgtttggttatgataacacaaccggaaaatataaggtggtggc |
277 |
Q |
| |
|
|||||| | |||||| ||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
20967359 |
ctatttcagattttcatttggttgcgataatacaaccggaaaatataaggtggtggc |
20967415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 20980182 - 20980238
Alignment:
| Q |
221 |
ctatttaaaattttcgtttggttatgataacacaaccggaaaatataaggtggtggc |
277 |
Q |
| |
|
|||||| | |||||| ||||| || ||||| |||||||||||||||||||||||||| |
|
|
| T |
20980182 |
ctatttcagattttcatttggctacgataatacaaccggaaaatataaggtggtggc |
20980238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 73 - 109
Target Start/End: Original strand, 20980028 - 20980064
Alignment:
| Q |
73 |
ttggttcatgcaatggattgatatgcatgctcagtga |
109 |
Q |
| |
|
||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
20980028 |
ttggttcctccaatggattgatatgcatgctcagtga |
20980064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 488 - 529
Target Start/End: Complemental strand, 15572138 - 15572097
Alignment:
| Q |
488 |
tacgattgaacaatttggcattatctcgcttgatttggggac |
529 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
15572138 |
tacgattgaacaatttgtgataatctcgcttgatttggggac |
15572097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University