View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18236_low_21 (Length: 264)

Name: NF18236_low_21
Description: NF18236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18236_low_21
NF18236_low_21
[»] chr6 (1 HSPs)
chr6 (1-264)||(2221673-2221936)


Alignment Details
Target: chr6 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 264
Target Start/End: Complemental strand, 2221936 - 2221673
Alignment:
1 cggttttgttggggatggttaagtcgggtcatatgatggatcaagttttgttgatgttgggtaatttagggtttggatcggatggtcgggctgctatgtt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2221936 cggttttgttggggatggttaagtcgggtcatatgatggatcaagttttgttgatgttgggtaatttagggtttggatcggatggtcgggctgctatgtt 2221837  T
101 ggatgcaggtgttgtggagtgtttggtgggtttattgtgtgggaacgagttggagtctgagtcgaccaaagagagttgtgttgtggttttgtatgcactg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| ||    
2221836 ggatgcaggtgttgtggagtgtttggtgggtttattgtgtgggaacgagttggagtctgagtcgaccaaagagagttgtgttgcggttttgcatgcattg 2221737  T
201 agtcttggtggcttgaggttttaggcggtggcaaaggaggtttgagttgtggaaatgttgcaaa 264  Q
    |||| ||| || ||||||||| |||||||||||||||||||| |||||||||||||||||||||    
2221736 agtcatggcggattgaggtttaaggcggtggcaaaggaggttggagttgtggaaatgttgcaaa 2221673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University