View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18236_low_21 (Length: 264)
Name: NF18236_low_21
Description: NF18236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18236_low_21 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 264
Target Start/End: Complemental strand, 2221936 - 2221673
Alignment:
| Q |
1 |
cggttttgttggggatggttaagtcgggtcatatgatggatcaagttttgttgatgttgggtaatttagggtttggatcggatggtcgggctgctatgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2221936 |
cggttttgttggggatggttaagtcgggtcatatgatggatcaagttttgttgatgttgggtaatttagggtttggatcggatggtcgggctgctatgtt |
2221837 |
T |
|
| Q |
101 |
ggatgcaggtgttgtggagtgtttggtgggtttattgtgtgggaacgagttggagtctgagtcgaccaaagagagttgtgttgtggttttgtatgcactg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| || |
|
|
| T |
2221836 |
ggatgcaggtgttgtggagtgtttggtgggtttattgtgtgggaacgagttggagtctgagtcgaccaaagagagttgtgttgcggttttgcatgcattg |
2221737 |
T |
|
| Q |
201 |
agtcttggtggcttgaggttttaggcggtggcaaaggaggtttgagttgtggaaatgttgcaaa |
264 |
Q |
| |
|
|||| ||| || ||||||||| |||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2221736 |
agtcatggcggattgaggtttaaggcggtggcaaaggaggttggagttgtggaaatgttgcaaa |
2221673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University