View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18236_low_25 (Length: 246)
Name: NF18236_low_25
Description: NF18236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18236_low_25 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 83; Significance: 2e-39; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 57 - 168
Target Start/End: Original strand, 698565 - 698676
Alignment:
| Q |
57 |
aacaagtaacatatatttgagtttatagattataannnnnnncactcaaaggtcgtccttttgttttgaaggtttcatccttattagttaatttaattca |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
698565 |
aacaagtaacatatatttgagtttatagattataatttttttcactcaaaggtcatccttttgttttgaaggtttcatccttattagttaatttaattaa |
698664 |
T |
 |
| Q |
157 |
acaataaattct |
168 |
Q |
| |
|
|||||||||||| |
|
|
| T |
698665 |
acaataaattct |
698676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 185 - 230
Target Start/End: Original strand, 699718 - 699763
Alignment:
| Q |
185 |
ttatcagctaatttatatgttattctctttaggttcatttcctatc |
230 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
699718 |
ttatcaactaatttatatgttattctctttaggttcatttcctatc |
699763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 11 - 68
Target Start/End: Original strand, 698486 - 698543
Alignment:
| Q |
11 |
cataggacaattttagtagtttttaacnnnnnnnatgagctactacaacaagtaacat |
68 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
698486 |
cataggacaattttagtagtttttaactttttttatgagttactacaacaagtaacat |
698543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University